Dataset for CDS BCL-2-like of organism Monodelphis domestica

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|F6SFL4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2A1 (length=519 residues).
atggatgattacgagttccattatgttcacatgttagctcgggactacttgaagcatgttcaacagacaccaccactggg
atcatgtctaaataagacatctcaaatactacaaaaggttgctttctctgtccaacaagaagtagaaaaggatatggaaa
catgcttgagcactttggacatcgtttctgtagagtctgccagaagaattttcaatagtgttatgaagaaggaatttgag
gatggcgtcattaactggggacggattgtcaccatatttgcttttgggggaattctcatcaagaagcttctgagacatag
agctccactgactatgggcactcaggaagaaatttctcattttattgccgagttcataatgaacaatatagcagagtgga
taagacaaaatggaggatgggaaaatggctttgtaaagaactttgaacctaatacagtgtggccgaacttcacagatatt
tcaacaaagatctggggcatattttcctttctgaagtaa
>gnl|bcl2dbcds|F6U940_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L2 (length=582 residues).
atggcgactccagcctcagccccagatactcgagccctggtggcagattttgtgggttacaagctgaggcagaagggcta
tgcctgtggaactggcccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgctggagacgagtttg
agtcccgctttcgacgcacattttctgatctggccgctcagttgcatgtgactcctggctcggctcagcagcgctttacc
caggtctcagatgagctcttccaaggggggcccaactggggccgtcttgtggcattcttcgtctttggggcagcgctctg
tgcagagagtgtcaacaaagagatggagccactggtgggacaggtgcaggactggatggtgacctacctagagacacagc
tggcagactggatccacagcagtgggggctgggcggaattcacggctctgtacggggatggggccctggaggaggcaagg
cgtctgcgggaggggaactgggcctcagtgcgaacagtgctaacaggggctgtagcactgggggctctggtgactgtggg
ggccttctttgccagcaagtga
>gnl|bcl2dbcds|F6VJQ0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L10 (length=570 residues).
atggattacaagtgtgctcttagggaagagacggcgcggctggtaactgactacctggaatattgttgccggagggaagg
cgtccaggagctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagcgagctccgccagatttaccagg
acttcttcgagtgcgccctgaatcagctactcgaccgggaacctgagcaagtaatcgtcaacgtagcggagctcatggac
cgaggcgagttcaactggggccgggtggcggtgctagtggtttttgccggggcgctgctggagatggaggaactactgaa
agaggagcaggtactgcagcttcggagggaaacgagccggcgtctgaccgaaaaactctgcaactatctggtggagagga
agggcgcgtggctgcatgagaacggaggctggactggctttcaccaccacttcgaaaaaaggcaatctcctccaccaagt
gactcaagtaataatacactgtgctgcataatggcagcagcagcaggatttggactagtgggattagctcttttattagt
cgtacgataa
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|F6YNL8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL-2 (length=771 residues).
atgatggctcaccctggaagaagaggatatgataaccgggagatagtgatgaaatacattcattataaactgtcacagag
ggggtacgagtgggatgctggagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctg
ttggaatcttctctacccagccacgaaacacaccattgcctgctgaaccccaggactcggccacttctactactgctgct
gctagaaactcacctttgcctcttcctcctcctgctgttgctgctgctgctgctgctggacctaccgtcagtccagtgcc
acctgtggtccacctgactcttcgtcaagctggagatgatttctctagaaggtaccggagagactttgatgaaatgtcag
gtcaactgcacctgacccctgttactgctaggggacgctttgccacagtggtagaggagctgttcagggatggggtgaac
tgggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcccctggt
ggacagcattgccctatggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggaggatgggatg
cctttgtggaattgtatggcaacagcatgaggcctttgttcgatttctcctggctgtctctgaagactcttctcagcctg
gctctggtgggagcttgtgtcactcttggtgcctacctgggacacaaatga
>gnl|bcl2dbcds|F6ZMX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1068 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
gtggaattctttcatgtacaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgttgctggagtagg
agctggtttggcatatctaataagatag
© 1998-2018