Dataset for CDS MCL-1 of organism Mola mola

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q3VP02_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mola mola GN=MCL-1 (length=789 residues).
atgaacgtgttgtttcaaaatggagtcgtgtcgggaccgacgcgttcctcgcaaatcgggatgggctcctgtctagactc
tcacaacggtaatgtcgctttaaacgatacctccaaacggcctaatttactagtagtgaacccaacgaaggaatatatgg
gaaaacccatccgaaaagacagcaccgacaccgacgacgacggttcgctgccgtacacgccggatatgtccccggacagt
gaactcaacgtctccggttgtttggcgggggatgaactgttggagaaggacacgaggcagctcattagccgcgtcttgat
ggaactttctggacacggaagagcacgatggactgaaagcagaacactatcaacgatgaaaagagtcgtggccgagcttt
tggaaaaacacagatacgtatacaatggtatgacaaaaagactgtcattggctgacacacaggacaatgtgagttttgtc
agcactgtatccagagatctgttttcagatggagcaacgaactggggccgtattgccagcctggttgcctttggggtcgt
ggtgtcccagtgcctgaaggagaacggcaagagtgaccgtgtggagctggtggctcatgagatctccacatacctgttga
cagaccagcgggactggatgtgtgtgggcggtgatggctttgtcgagttctttcgagtagcagacccagaatccacggtg
aggaacgcgctcatgaccattgctggagttgctggtattggggcgacactggccctgttgatcaggtga
© 1998-2019