Dataset for CDS BCL-2-like of organism Mesocricetus auratus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A1U7QU73_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggagccgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtgaagcaagcgctgagagaggccggcgatgagtttgaactgcggtaccggcgggcattcagtga
tctgacatcccagcttcatataaccccgggaactgcatatcaaagctttgagcaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A1U7QVA0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L10 (length=549 residues).
atggccgacccgctgcgggtccgcactagactgctgctaactgactacttgacgttctgtgcacgggagccgggtgaccc
cgagccaccgcccacgtcggcagaggcggccttgctgcgctctgtggcagagcagatccaacagcagcaccacttttttt
tctcctccttcgtcggctaccagggcaaccgcgtggagctgatgacacagatggtagacgccgtgctccccgatggccaa
gacctcaactggggccgcctggtgttgctcttagcctttgcggggacaattgtgagtcaagagcagagaaaccgtctgaa
ggataaaatgaaagtgctccaagactgccaactcatagtggccttgctgtgcaatcgactcctgaggcggcatcgctcct
ggctggaggctcaaggtggctgggatggcttttgtgtcatctttgggagtcccttaccactcgatttttggagcacactg
ctgatcaagacttttctgtcctgtgtcattgcaacagccatcctgtttgtctggaaaagactattataa
>gnl|bcl2dbcds|A0A1U7RC37_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggcta
tgtctgtggagctggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgcttccggcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaattggggccgtcttgtggcattctttgtctttggggccgccctatg
tgctgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
tggctgactggatccacagcagtggcggctgggcggagttcacagctctgtacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A1U7RC37_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggcta
tgtctgtggagctggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgcttccggcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaattggggccgtcttgtggcattctttgtctttggggccgccctatg
tgctgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
tggctgactggatccacagcagtggcggctgggagctagaagcgatcaaagcccgagtcagggagatggaggaggaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgttctatctatgttggcaatgtggactatggtgcgacagcagaag
agctggaagcccactttcatggctgtggttcagtcaaccgtgtcactatactctgtgacaaatttagcggccatcctaaa
gggtttgcatatatagagttctcagacaaagagtcggtgaggacttccctggccttagacgagtccctgtttagaggaag
acaaatcaaggtgattcccaaacggaccaacagaccaggcatcagtacaacagaccggggtttcccgcgtgcccgatacc
gtgcccggactaccaattacaacagctcccgatctcgattctacagcggttttaacagcaggccccggggtcgagtctac
aggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2018