Dataset for CDS Unclassified of organism Maylandia zebra

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P9BV81_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra (length=681 residues).
atgtgccagatgatacactggtatgactggcaggagagatcgtggcatttgattagcctggccctgcagaggaggtccag
agtggagatgcagtgcaggaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaactt
cccttctgaggccaaccaatgtgggccaaaggactgagagagacctggccaaatccctgcctgcgtacgatggcatagag
gctttaaaatcagctcttctagactcaggagagcagtttggttttctgttcacacagtcttttagggacgttgcttcgca
cctcaacatcacgccagacacagcccagcaatgcttcgagagtgtgatggatgagttgttcagggatggaatcaattggg
ggcgtataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgggtgagctggtaccc
gacattgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctt
tacagagatatttgggaaagggatgtctactaggagctctggggagtctctgaagagatggctgtttgttggagtggcat
tagtaacagggctgctggttggcatgctcatgacagattaa
>gnl|bcl2dbcds|A0A3P9CX04_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Maylandia zebra (length=597 residues).
atggccgccgcctacagcagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggcttggcc
tcagcgccgggccaatgacgagagagccccgcgtccagaccctcctgtggccccaccctgcctgcagaccgtgctgcgga
gcgccggcgatgagttggagcgactttacggcaacgagctgtctgcgcaggtgacggtgctgcaactgcgtgggaacggc
ggtggcgctgcacgccggcgccacctgacggctatcagagaggagctgttcagggatggcgtgaactggggacgcatcgt
cgccatgatggagctgggcggagctctgagcgccgcggccgccaagtcgggcgacgaaggtcagatggacgatatcgcca
gctggatggaggagagtctggactcgccgtcgctccggagatggatccatgacaacggaggatgggatgcttttgtggag
ctgtatgagtccagacccactgacagcttctggtccctgaggacagtgtgtggactggtcgtactgggagcagttggggt
catactgggatttctattcagccagaaacaaaactga
© 1998-2019