Dataset for CDS MCL-1 of organism Maylandia zebra

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P9BVM3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Maylandia zebra GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgtaccctaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatctggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccagagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcttttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaattacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
© 1998-2019