Dataset for CDS MCL-1 of organism Mastacembelus armatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3M6G2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=852 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagttactgtggtgtaatgtga
>gnl|bcl2dbcds|A0A3Q3M6G2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=891 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagcagaaataataaaatgctgacttctcaaagtgccatcagcgcgcctg
tctcagcatag
© 1998-2019