Dataset for CDS BCL-2-like of organism Mandrillus leucophaeus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A2K5XRD4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6AD55_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6AD55_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6AI30_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6AI30_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2018