Dataset for CDS Unclassified of organism Macaca mulatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7E8W0_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta (length=180 residues).
gtggttcaagaaaatggctttgtaaagaagcttgagcctaaatctggctggatgacttttctagaagttacaggaaagat
ctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgattgcca
acacatacttctacttttaa
© 1998-2018