Dataset for CDS BCL-2-like of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A1D5QRF2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL-2 (length=750 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctc
ccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgcca
cggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgt
gtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacct
gcacacctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctggggccacaggttcgagg
tgcgggggttggagtgcgggtgggctcctggggcaaggggaggctgtggagccggcgaaataaaatcagggttgttgctt
cccggcgtccctacctcttcctctggataa
>gnl|bcl2dbcds|F6UKR4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|F6UKR4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|F7E8V5_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2A1 (length=471 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccactag
>gnl|bcl2dbcds|F7E8V5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1167 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ctaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7G4L5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|F7HUE9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcgtcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7HUE9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
© 1998-2018