Dataset for CDS BCL2L2 of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|F7G4L5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7G4L5_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1167 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ctaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2018