Dataset for CDS BCL2L10 of organism Macaca mulatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
© 1998-2018