Dataset for CDS Unclassified of organism Macaca fascicularis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5WP17_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis (length=237 residues).
acagcacaatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaacgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgattgccaacacatacttctacttttaa
© 1998-2018