Dataset for CDS BCL2L1 of organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
© 1998-2018