Dataset for CDS BCL-2-like of organism Loxodonta africana

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|G3T756_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=1026 residues).
atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggcttgggggccggcggctgcgc
cacccctccgggagggcgacttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggggacgccggcg
cgagccccccggccgctgtcgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggagatggaggctctagccgc
cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagccgctcgggaagcggccggctgtttttcccc
ggctggggctggtcggggaggccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcaggcaaccggcgccaaggacac
caagccaatgggcgggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacggggtgcagcgca
accacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatcttttggtgcctttgtggccaa
acacttgaagagcgtaaaccaagaaagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaaggacgaaaa
gggactggttagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G3T8E6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2A1 (length=528 residues).
atgactgactgtgagtttggatacatttacaagctggtccaggactatctgaagtacgtcctgcagataccacaacctgc
agctggttcaagcaaaacgtccagagtgttacaaaatgtggctttctcagttcaaaaagaagttgaaaagaatttgaaac
cctgcttggacaattttgttgtcatctccattgataccgcccaaacaatattcaagcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtgaccatatttgcatttggaggtattctcatcaagaaacttctaagggagcg
aattgccccagatgtggatacttacaagaagatttcttcttttgttgctgagttcatagtggataacacagcagagtgga
taaggcaaaacggaggctgggaaaatggctttgtgaagaagtttgaacctaggtctggctggctgacttttctggaagtt
acaggaaagatttgtgaaatgttatttctcctgaagcaatactattga
>gnl|bcl2dbcds|G3TMU7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L2 (length=627 residues).
tatattcatgttagtctttcatccctgactcttgcagccgcccgcatggcgaccccagcctcagccccagacacacgggc
tctggtggcagactttgtgggctacaagctgaggcagaagggttatgtttgtggagctggccccggggagggcccagcag
ctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggca
gcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaa
ctggggccgccttgtggccttctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatggagccactgg
tgggacaagtgcaggagtggatggtggtctacctggagacgcggctggctgactggatccacagcagtgggggctgggcg
gagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggac
agtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3ULB7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=504 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctgacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcc
cggtgccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgag
atgtcgagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacgg
ggtgaactgggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagga
tgggtaggtgcatgtgtggttgaa
>gnl|bcl2dbcds|G3ULB7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=690 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctagcgccgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
cggcgccccggggcccggacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgagatgtcgag
ccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggatgggatgc
ctttgtggaactgtatggccccaacatgcgacctctgtttgatttctcctggctgtctctgaagacactgctcagtctgg
ccctggtgggagcttgcatcaccctgggtgcttacctggggcacaagtga
© 1998-2018