Dataset for CDS BCL2L2 of organism Loxodonta africana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3TMU7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L2 (length=627 residues).
tatattcatgttagtctttcatccctgactcttgcagccgcccgcatggcgaccccagcctcagccccagacacacgggc
tctggtggcagactttgtgggctacaagctgaggcagaagggttatgtttgtggagctggccccggggagggcccagcag
ctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggca
gcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaa
ctggggccgccttgtggccttctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatggagccactgg
tgggacaagtgcaggagtggatggtggtctacctggagacgcggctggctgactggatccacagcagtgggggctgggcg
gagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggac
agtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
© 1998-2018