Dataset for CDS BCL2L1 of organism Loxodonta africana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
© 1998-2018