Dataset for CDS Unclassified of organism Lottia gigantea

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|V3ZZU7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Lottia gigantea (length=699 residues).
atgtcgactaccggaatggacagtaatttatatgcttctaaagtatcaaatatgatcgttaataagagtttatttgctga
attgagtaaacaatacagatcactgcccggagcggcgggcttgaacgacattggaaatgttgatgaatgcacacaaacgc
cagggagcagttcgcctttggaacaagttagaagagatgcagaagttattgcaaatgatgttgtattaacattcggtgca
gatgaaaccaagaaagctacaaacaaatattgcaaaacaatgcgcagaactgtgaaagaaatctcagagcgacatgacat
ttcattcaagggtatggtaaacaagctcaaagttgaggaatcaggacgtacttttgagacatttgttaatgtggcagatg
aaatttttgatgatggtcaaataaattggggaagaattgtcgcagtttatgcttttgcagctcgtttagccaactattgt
cgccagaaagatttaaatgattgcccagaaaaggtttccttatacgctgggaaatatgtgggaagtaaattagggaaatg
gattttagaccatggaggctgggatgcttttgtggaatttttccctgatcatggtgaatttgaagaaaaagtatggaaag
gtctcctgtttacagcagttggtttgggagctctagctacagtcgttgcttctcggtag
>gnl|bcl2dbcds|V4B1H3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Lottia gigantea (length=561 residues).
atggatgacgaattgtcaaggaatattgtccaagactatgtgagttacagattgagaaaaaatggccatagatggcaaaa
tggacccatgatcgagggtgggccgagtaggatttgcttaactatgcgaagtttagctgatgaatttgaagataggtata
ggtctcaattcgaggacatggtaaatcaattagaaataactccaggaatagcttaccagactttcagatcggttgtgagt
gaattatttagtgatggcgtgaattggggacgaattgtagcattgtttacatttggaggttcaatatgtgtacaatgtgt
tgaaaataatatgcctcatgtggtggataatgtcgtggactgggttactacatactgtgataatgatttaaagccatgga
tagattcacacaactcatggcaaggatttgttgcattttacgacagagaacctgaaaggagaaatgatagcccctggaca
tcttttcgtaagatttgtggatttgcagcaggggcaataggtgttttaactttaggggccatcttaacccaaaagtcatg
a
© 1998-2018