Dataset for CDS MCL-1 of organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
© 1998-2018