Dataset for CDS BCL-2-like of organism Lepisosteus oculatus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
>gnl|bcl2dbcds|W5N4F7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL-2 (length=696 residues).
atggcaaataacgaagccccgtacgatactcggaatatcgtgacaaaatacatccatcacaaactcctgaagaagggcta
cgtgtgggaatcccgcgtgtccggcgagaccgatccccccaataacggattggtgggcccctccgcctcgggtccggggc
tgcaggcgcggcggctccaggctgccggggccgagcgcggagctgtcccggtcccccgccggacccccccgcccgacccc
cacgccgctctccacaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgggacttcgcggagatgtc
ggatcagttgcacttcacccccaacaccgcccggaggaagttcaccgcggtggtggaggagctgtttcgggacggagtca
actgggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggagatgacgtcccag
gtggacaacattgccaactggatgacggagtatctcaacgggccccttcagaactggatccaggagaacggaggctggga
cgcctttgtggagctctatgggagacagagaggctccatgttcagctgttcatggccatctttgaagactttctttggtc
tagctgctctgggcgcagcaggcctgaccgttggagcctactttacacaaaaatga
© 1998-2018