Dataset for CDS BCL2L2 of organism Latimeria chalumnae

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|H3AAS7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
>gnl|bcl2dbcds|H3AAS7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
© 1998-2018