Dataset for CDS BCL2L1 of organism Latimeria chalumnae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
© 1998-2018