Dataset for CDS Unclassified of organism Labrus bergylta

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3GJH9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Labrus bergylta (length=585 residues).
atgtctgccctctataacagccgggacatcgtggaggacttcctgcgtcacaggctgcagcaggacgggcgagttacgct
cccgccgcgacgacatcacgccgctttgaggtcgacttccacatcgtcactgacatggagagctgttcgagtgatgacat
cacaccgagactttcacccagacctcacggccgtcctgcggagtgcctgcgacgatctagcacgccgttaccatggcgac
ctggcggccaacctgtcggcgctgtcgcagcaagacggcgttgaggcggcagggctcgggggtctgacggcggtgaggga
ggagctgttcagagacggggtgaactggggacgtatcgtggccatgatggaggtgggcggagccgtgtgctctgaggcgg
tgaagacgggcggggcgcagcaggtggaggtgatcgccggctggatggaggagggtctggactctctccagggatggata
gacgataacggaggatgggtaggtgggcttctgtttcctcttcctcctcgtcatcatcaacgagccggtgactgttccag
tgtgttaggttttaattatctctga
>gnl|bcl2dbcds|A0A3Q3GJH9_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Labrus bergylta (length=570 residues).
atgacatcacaccgagactttcacccaggtgaggaggtttactgtgttgtcatggtaacgtttattgaagcgataactag
tcgactgctaacaagcccctcccccagcagccctgcagcgttctgcccccaccaccaatcagagggcagtgggcaggtgg
ggggggccttaaagagacatgcctgcgacgatctagcacgccgttaccatggcgacctggcggccaacctgtcggcgctg
tcgcagcaagacggcgttgaggcggcagggctcgggggtctgacggcggtgagggaggagctgttcagagacggggtgaa
ctggggacgtatcgtggccatgatggaggtgggcggagccgtgtgctctgaggcggtgaagacgggcggggcgcagcagg
tggaggtgatcgccggctggatggaggagggtctggactctctccagggatggatagacgataacggaggatgggtaggt
gggcttctgtttcctcttcctcctcgtcatcatcaacgagccggtgactgttccagtgtgttagatgctcctattggtca
atttgaataa
© 1998-2019