Dataset for CDS BCL-2-like of organism Labrus bergylta

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A3Q3EZU5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=621 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3Q3EZU5_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=630 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctgatccgagtgcaggcctga
>gnl|bcl2dbcds|A0A3Q3FUB6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=666 residues).
atgtcatacagtaacagagagctggtggagttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
gaggtcagaggatgctggtgaaaggactgagggagacatggaaaactctgctgccagtaatggctttttggtcaacagca
ggaaccgggccggccagtcagtgatgtcatcatccccacacaccgacatagaggctgtaaaggcagctcttctggactct
gcagatgagtttgagcttctctttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaacacagccta
tcacagctttaagagtgtgatggacgaggttttcaaggatggagtcaactgggggcgtatagtaggcctgtttgcctttg
gcggtgtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggatgactacgtac
ctggatgagcacattagtgcatggatcgagagccagggaggatgggactgctttgttgaaattttcggacggggcgctgt
tggagaagtgaggagatctcgggaaactctcaccagatggctgctagttggaatggcgctgctaatgggagtcgtggttg
gtgtttacatcgctaagaaacattaa
>gnl|bcl2dbcds|A0A3Q3G1D7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Labrus bergylta GN=BCL-2 (length=690 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgtcataaactctccaaacggggctacgagtggggatt
cgaggatgagcaggatgaagatgctgctaataacgggtcattagttgcccctccgccgactttggttcgccggtgccgtg
aagcgagctccgggcctgaccgtgagagcatcccccacctctgcaaacggcccccccagtccgacccagcctacgcggat
atccacagagtcctgcgcgaggctggagatgaacttgaaagactttaccagccggacttcacggagatgtcgcggcagct
gtatctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgtttcgggacggggtgaactggggcc
ggattatcgcctttttcgagttcgggggcacggtgtgcgtggagtgcatgtccaaacaggagatgacatcgcaggtggac
aacatcgcagagtggatgacggagtatttgaatggacctctgaacagctggatacaagataacggtggatgggatgcctt
tgtggagctgtacgacagacagagagactcggccttctgctcctcctggccctccattaagacagtcttcggtctggcag
cactcggggcggctagcctcaccattggagcataccttacacagaaatga
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3GP42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Labrus bergylta GN=MCL-1 (length=825 residues).
atggatatcattaatatgaagcgggcggcggtcagcgtatctgccggagtcatgagctttatgatgccacaaaatggagt
cgggaagggacagatgcactacggcccggaagcgtcctctccacaaatagcgatgggatcctctttagcctcacaaaatg
ggaatgtcgggtcgaatgaaaccaccaagcggcccaaggctctggttgttaactcgggaaacgacgatatcgaagacggc
tcgctgccgtgcaccccggagccggacagtgaaaccgaagtctccagctgtcccactgggggcgaagtcctggagagcga
caccaggcaactcatcagcgccttcctcagagagcatactgggctttcaaagcctggttggaatgagagtagtgcactat
cgacgatgaaaagagtcgtggaggacgtgctggcgaaacacagatacgcgtataatggtatgatcaacaaactgtcactg
gaagacagaggggacgatgcaagttttgtcagcgctgtggcaaagagcctttttgcggatggaacaacaaactggggcag
gatcgccagcctggtcgcttttggagcggctgtgtcacaatacctgaaggagaatggcagggggcactgtgtggagctgg
tggggcaggagatctccacgtacctgctgtctgaccaccgggactggctggtcaaaaacaacgcctgggacggctttgtc
gagttctttcgagtagcagacccagagtccacagtgaggacaacactcatggcttttgctgggttcgcaggaattggggc
cacgttggccctgttgatcaggtga
© 1998-2019