Dataset for CDS BCL2L1 of organism Labrus bergylta

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3Q3FUB6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=666 residues).
atgtcatacagtaacagagagctggtggagttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
gaggtcagaggatgctggtgaaaggactgagggagacatggaaaactctgctgccagtaatggctttttggtcaacagca
ggaaccgggccggccagtcagtgatgtcatcatccccacacaccgacatagaggctgtaaaggcagctcttctggactct
gcagatgagtttgagcttctctttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaacacagccta
tcacagctttaagagtgtgatggacgaggttttcaaggatggagtcaactgggggcgtatagtaggcctgtttgcctttg
gcggtgtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggatgactacgtac
ctggatgagcacattagtgcatggatcgagagccagggaggatgggactgctttgttgaaattttcggacggggcgctgt
tggagaagtgaggagatctcgggaaactctcaccagatggctgctagttggaatggcgctgctaatgggagtcgtggttg
gtgtttacatcgctaagaaacattaa
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
© 1998-2019