Dataset for CDS MCL-1 of organism Kryptolebias marmoratus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=819 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagtgtttgttggccttga
>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=1047 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcatgtgtatctctggcgcctgggatcagaagtt
gctacctaagcacaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacaggatgagtcaaac
cttaatattgggtggatcctgcctcttcacaatgactgctggagacaggcaccagctccctgcgtctctgcagggaaaag
ggagtaa
© 1998-2019