Dataset for CDS BCL-2-like of organism Kryptolebias marmoratus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q3B0R2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL-2 (length=894 residues).
atggaggtgaatcgcttcattgtggaaaactatatttgccacaaactctccaagcgcggctacgcgtggggctccgaccg
cccccgccgcgtccgagacgatgctgccaacaacggctcggtggcgagccagtccccgaccctggtccggaggtgccgcg
gcgcacgaggagccccaggaggagcaggaacggcgccccctgacgcggagagcgaccccgaccccgtcctctgcgggcgg
atctccccgcacgagccgctcgcgcacatccacagggtgctgcgcgaggccggcgacgagctggagcgcctctaccagcc
ggacttcgtggagatgtcgcggcagctggggctcgccagcgccgcggccaaggcgcgcttcgccgaggtgatggacgagc
tgttccgggacggcgtcaactggggccgcatcattgccttcttcgagttcggcggcacggtgtgcgtggagtgcgcgtcc
agggaggagatgacgccgcaggtggaccacatcgcggagtggatgacggagtatttaaatggacctctgaacagctggat
agaggataacgggggatgggatgcgttcgtggaactgtacgacagacacaaggagtccgtcttcagctgctactggccgt
ccatcaagacagtcttcggcctggcggcgctcggggcggccagcatcaccatcggcgcgtacctcacgcaaaagatgccc
ctgacccctcagagacaaccttcagaccagatctggctctcttcaaagcctcgctcagagaactgctttcctcctcctgc
gcctccatgtcaaaacagacacaaatcaaaacagcagagggaaccagaggcacggcccagagagcaaaggatgtctgagg
tggaatcacactag
>gnl|bcl2dbcds|A0A3Q3B3X5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=699 residues).
atgtctcaaaacaaagaactggtgcttttctatattatgtataaactgtcacagagaaactatcctgtcaatcacataat
actcagtgatcctccgaatagaactgatgcaggggatgcagggttggaggacgcagagatgacagagacacacgccaatg
ggacttttaacgggactagtcctgggaccccgccggcgtccccactgaggcagcaaccgctgccgacgacggcgaacatg
gacaaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggtacgcccgcgctttcagcgacctgcacag
ccagctgcacatcacgcccggcaccgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcattgtggggctctttgcattcggcggagcgctgtgcgtcgagtgcgtcgagaaggagatgagtcacctggtg
gccaggattgtggagtggatgaccgtctacctggacaaccacattcagccttggattcagagtcaagggggatgggagcg
ctttgctgaaatcttcggcgacaacgcggcggctgaaagcagaatctctcaggagggtttaaagaagtggctgctggtgg
ggatgacggtggtgaccgcggtggtggcgggttcgctcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=819 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagtgtttgttggccttga
>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=1047 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcatgtgtatctctggcgcctgggatcagaagtt
gctacctaagcacaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacaggatgagtcaaac
cttaatattgggtggatcctgcctcttcacaatgactgctggagacaggcaccagctccctgcgtctctgcagggaaaag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3BEB7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=657 residues).
atgtcacacagcaacagagatctggtgcagttctacataagctataagttgtctcagaggaactgttcgaagtctctgct
gatgccggaggttgccggtgaaaggaccgagaaggccagctcggctcccagtaacggcttgctggtcaacagtagggacg
gccagtcggggaagaagatctggccccgccgcagcgacatagaggccgtaaaatcagctctgaaggactctgcggatgag
tttgagcgtctctacacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgacacggtctaccacagctt
caagagcgtgctggacgagctgttcaaggacggggtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
tgtgcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcattgcagactggatgaccgtttacctggatgag
cagatcggtccgtggatcgacagccagggaggatgggacagcttcgctgagatgtacgggcgagatgccgctgcagaagc
gaggaggtttcaggagtccctgaagaaatggctgctagctggagcggcgctgctggctgggctgcttctcggcgtgctcg
tggctaagaagcgttaa
© 1998-2019