Dataset for CDS BCL-2 of organism Kryptolebias marmoratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q3B0R2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL-2 (length=894 residues).
atggaggtgaatcgcttcattgtggaaaactatatttgccacaaactctccaagcgcggctacgcgtggggctccgaccg
cccccgccgcgtccgagacgatgctgccaacaacggctcggtggcgagccagtccccgaccctggtccggaggtgccgcg
gcgcacgaggagccccaggaggagcaggaacggcgccccctgacgcggagagcgaccccgaccccgtcctctgcgggcgg
atctccccgcacgagccgctcgcgcacatccacagggtgctgcgcgaggccggcgacgagctggagcgcctctaccagcc
ggacttcgtggagatgtcgcggcagctggggctcgccagcgccgcggccaaggcgcgcttcgccgaggtgatggacgagc
tgttccgggacggcgtcaactggggccgcatcattgccttcttcgagttcggcggcacggtgtgcgtggagtgcgcgtcc
agggaggagatgacgccgcaggtggaccacatcgcggagtggatgacggagtatttaaatggacctctgaacagctggat
agaggataacgggggatgggatgcgttcgtggaactgtacgacagacacaaggagtccgtcttcagctgctactggccgt
ccatcaagacagtcttcggcctggcggcgctcggggcggccagcatcaccatcggcgcgtacctcacgcaaaagatgccc
ctgacccctcagagacaaccttcagaccagatctggctctcttcaaagcctcgctcagagaactgctttcctcctcctgc
gcctccatgtcaaaacagacacaaatcaaaacagcagagggaaccagaggcacggcccagagagcaaaggatgtctgagg
tggaatcacactag
© 1998-2019