Dataset for CDS Unclassified of organism Ixodes scapularis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B7Q4U7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ixodes scapularis (length=858 residues).
atggccgtcaacgagaccgacaagacgcaggtttccgagatggtgaacgacttcctgcgctaccagctcaaccggcggga
cctgcagtggactacatgcccgccattgccccggcccagcaaagtggtcctcgttctccgaacgctgggcgacgaattcc
tggccaagtaccgcgacgagttcgtccagatgtgcggccggctcgacctgactccctcggtcgcccagaccgccttcctg
gacgtgctcaacgagcttttcagcgaggggattacctggtcccgagtggtgggcgccttcgctttcagcttcgagctgtc
cgcgcactgcgtcgagaagaactggtccgacctggtggacggcattgcgtcctggttgtcttcttacgtgtgcacgaggc
ttctgccctggatacaggaccacggaggatgggtaagcgatcctcctacccgcattccttccccgcgcgcgagcgccgcc
ttccacgacgccgggtttcggcgtggcggccggcgtttttcattgagccagtttctgctgccgcgtccaacggtctcgct
ccccctcaatggggggctgtcgtgtcgctcgctgccgccgcttccggctcgctcggcttatctcggggacgcgaactccc
cccactccctcaagccggccccagtttgctcgcataccgaggtctgggcggacgccgaacccccgcaagctccaaagagc
ggggcacggtctactcgtcgaagcggttgtgacgccgcgaggacgctgatcgagccgaaacctttggaaaaaatcaaaac
agccgaatgtggcgtgcatctcgtcgtaccttccggttcattcatacctagagactaa
© 1998-2018