Dataset for CDS BCL-2-like of organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|A0A287DCH9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=1002 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcgc
caccccgccgggagcgcagctcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccgccc
agccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccccggcgagg
cgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgtcgcccgaaga
ggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctgtaccggcag
tcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtgggtcgggggc
cgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggccttccaaggca
tgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgga
gtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagag
gctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggt
gttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=852 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgaggtccccgacgtcaccgcgac
cccggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgt
cgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgtt
ggagaggccgccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagct
gtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggcc
ttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgtttt
cagtgacggagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagca
taaaccaagaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtc
aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|I3MCZ7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2A1 (length=528 residues).
atgaatgactgtgagttcaggttcatccacacgctggctcaggactacctgcagcacgtcctgcaggtaccgcaacgtgg
gtcaagccccagcaaaacgtccaaagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaatctgaaac
cattcttggacaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcatgaactggggaaggattgtgaccatatttgccttcggaggagttctggtcaagaaacttctgcgagagcg
gattgcccctgctgtggattccgatgaggagatctcttactttgtggctgagttcattatgaataatgcaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggttgacttttctgggagtt
acagggcagatctgtgagatgctgtctctcctgaagcaatactattga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MVK9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL-2 (length=588 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccataccccggccgccaggacctcgccaccgccacccccggctgcccccgctgccgccgcggggcccgtgctcagc
ccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccga
gatgtccagtcagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggtaggtgcacgtcgggttgaatga
>gnl|bcl2dbcds|I3ND50_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|I3ND50_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=507 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggctgttctccagggggaatatgggggctctgattggaggctgggacagc
tgtgctgggaaggaggcatggggctga
© 1998-2018