Dataset for CDS Unclassified of organism Hydra vulgaris

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A1E3K7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=537 residues).
atgtcagatacaccaattaatttcaataccccggaagctaaaatcgcaaaagaagtagcgtatcaacttatacaaaaaaa
gacaggtaaaaatataaagaatcagcaaattcgtaaagaaacagaacttatgatgagattagtcgaggaaatagaaatta
aacacgaactgtttttgtcaaatatgtgtaaaagactgaacttaaatactgaaaatgctcaatcaatgtttcacacaatt
gcagaagagatattcagtgatggtattaactggggtagaattattgtcttatatgcgtttgctggaaaaattgcagaaca
ttgtagaaaatctaatgatgaacaaattattgataaaattgcattatgggttgcaggttttgtagccaaaaaaagtagtt
ggattcgtgattcaggaagaggatggaatggctttattgaaaactttgatgtcaagcaagactcgtgggttcagggattg
tttgctgctactttaggtttaggaaccatagctgctgcactttacatcaaaagctaa
>gnl|bcl2dbcds|A7LM79_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=618 residues).
atgacaacgaattctttttctaacgtattatgcaatctggaaacaccttgtaacaaaaatgttgaaccatgtgataaaaa
aaatattgaaaatacattgaacaatgaaataaaattatcgaaaacatatatagacagtctattagtagcaacatatgttg
ttaaaaaacgtataggtattcagcaaaagtataataaaataggagaaaaagtatttgaattatgtctggagctggtaagt
aaacatgagactttttttaataatttgacaaatgaactaaatatatcaagagataacattaaagaagttataaaaatcgt
tttgagaaatgtcttgaaagactcaattaatttcggaagaataacttcgattttagccgtttgtatgatagtcagtgaac
attgttataaaaatgaatcgatgtcagacaaagtatgtttaattgtagaaactactgctgaaattatctatgaaaatagg
aaatggtttgaagctaatggtgcatgggatggactaatgaagtatttttttaatcctacagactacttttggaaaggttt
tgtagtaactactgttggattaggcgcaatggctggtctattgtatgcaaaatcataa
>gnl|bcl2dbcds|A7LM80_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=579 residues).
atggctggacctcctaatgctcaagaagacaattacaaacgaatagttaaaagttatgttggagaaaagttaaggaaaaa
aggattaaaaattcgtggatatgaaggagaggaattaaaaccacctgtcattgaaatagcaaaaacactacaaagagttg
gagatgaacttgaatcagccaatactgatttttttaaaaatatgtgtgaccagttacaaataacaccaagtactgcatac
cccacatttcagtctattgcagatgagatatttgtttcaggtaaaaattggggtagagtagtagcatttttaacatttgg
aggtaattttgctgtacattgtgctctaagagcagatatgggagaagaatatgtagatagagttgttaattggatttcta
aatacatggccgttaatcttgattactggattaatcaacaaggtggatgggatgggtttttaattttctttgaaaagacg
aaaaataacgacgatgaacagggaagtcagagtgtttttttggtatctgcactagcgggactgggtgtgggcgcattact
tatgttaacgtttaaataa
© 1998-2018