Dataset for CDS BCL2A1 of organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|B4E1X9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggtatgtgtgatggaaaaattcttcattgttctttcctgtgaaatagaaattgagaatttc
cttgctagttaa
>gnl|bcl2dbcds|Q16548_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacacacctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|Q16548_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
© 1998-2018