Dataset for CDS Unclassified of organism Helobdella robusta

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|T1EKX5_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Helobdella robusta (length=276 residues).
cagaaaacatttcgaaacatgatcaaatcattggatatttccagtgtgaattctgcaaggttgtctctaagaagagtatt
tgaagaggttttcagtgatcgaaactgcaattggggtcgtatcgtaaccattgtagcattttctgttgaagtctcaaggt
ttggacagaaattgaacaatgaagatagcaaacactttccagaaaaaatatcagaatttgtttcagaatacataaacgaa
tatctgtctacttggattgtatctcaaggtggttgg
>gnl|bcl2dbcds|T1EKZ7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Helobdella robusta (length=213 residues).
cgagttctaaaagaaatgttctccgacggccacacaaattggggtaggattgctaccctttttgctttcggagcggctct
ctgtaaatattcccttgaaaataacaagcaggagcttatagaaccaatcacagactccatcgcactctacatttctacaa
ataaatccaactggataaggcaacaaaatggctgggttggtttttttttattt
>gnl|bcl2dbcds|T1FMT5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Helobdella robusta (length=573 residues).
atgtcatctttagaagcaactaataagattcttgcagctgattacatttacttcaagctgaggaaaagtagatttgattg
gccagtgagatgtcctgtcgatttgaaaaaagatggcggatgtgctgaagccaagttggctatgagaaatttgggagaag
agtttgaggagagatacagaggtgtattcaatgacatgtgtcaacaactgcacataacaccaaacaatgcatcagcaaca
ttcagagccatcattggagaattattttctgatggaatcaggtggggacggattgttgccctgttctcattttcaggttg
cctggcagttgaatgcatggagaggaagatgcctcacctggttgatgaagtactcacctggacgactgcgtacctcgatg
aacatctctccaaatggatacaagataataatggatgggatggctttgttgaattctcgaaaggagggcaaacgaaggag
tcaccctggccgtcattcaaaactttatgtggatatgctgtcggtgcactgggagttctcacgctgggcgccatcttgtc
tcaaagatcctga
>gnl|bcl2dbcds|T1FPP3_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Helobdella robusta (length=987 residues).
atgggtgacatcttcatcagtgaagaaaatgagaaacttcttggcggtcgagaagatgatgtagttgcagttggcggtaa
ttacaacgacgacgatgatagcatttctgacattactactactactactactactactactactactactactactacta
ctactactactactactgttgccacaactacaactatcgccactaacagtataaataacaacaatgcttataacaacggt
gataacaacaacaatacgaataatagtgacagcagcagcagcacaactcgaaatcgtagtagcacccaccagcgacaaaa
ccacgccaaccaccaacgtcgacatcgacgccatcagactagcagcgacgacgcagctgccagagacttattctacctga
acgatcgttttattacggaagaatttcgaaacaagtgtgcggaagttgcatatgacattgtcacttacgtctgccatagc
gggccctatcagccctaccctccccctagtaagaccactcgactgatgaggaaccttgtgaatgatttggcgaaaaatcg
cggagagctgatggatgatatggcatcccagatcgttttgaacgccaaatcgatggaacaactggagatcctactgaacg
aactggcctccgagatgttcaacgacaacgtcataacctggaacaggatagtgatgtaccatgccttctgcgcctacgtg
gccaagttctgcaaactccatgagagcattgaggacatcgaggaggtggtggtgaggattctcgtcgacattgttgttaa
cagactgggtctctggattgccacctgtggtggatgggctcagttcgacagtcagttccctatgctatgctgcatactcc
aaagtggatgcatatggaaagttctcctgttggtatgtgcattcattggcactatcgtcatcttctataaggccatacac
ttcctggatagttccagaaaaatctga
© 1998-2018