Dataset for CDS Unclassified of organism Haplochromis burtoni

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A3Q2V6F4_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Haplochromis burtoni (length=687 residues).
atggccagtaactcaagagaccttgatgagatgccacaaccgcggacctcagatcgcgtggtgagaccgtgctggctgaa
catagacgcatcgggtccacgtgttatcgtctctgacgggttgagccaaagtgtccagcatctcaacgacccccccacct
tcggatccggttggttggcagacgccacgggcatgattcacatcgcagggtcgtatgacacgtacaaatgcgtagactgc
aacatagtcttgtcgggatacaaaaaggccgacagaagcctaaacgagcacgtccttctgccaacgatcacacgtgtggc
acgcaccttgttttcagacggcattataaactggggacgcatagtaagccttgtggcttacggcacagtgttactgcaag
cgtcgaagtcaaccttgggacccgagtgcgcttacgcgatcggcgtgtcgatagcggcttacattacagacaatcacatg
gattggctcgctggcaccgatggttgggtatgttctttctttactgttttttttcgtcccttttgcctagtagacacttt
taagcttgcgtggcatggtctacgaggtcctgggatgacatcgctcggaatcttacacacacagagggcgcttcggtcga
acactcctaaaacacaaggcggagttctggtgggcatgtgtgtataa
>gnl|bcl2dbcds|A0A3Q3CNF3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Haplochromis burtoni (length=597 residues).
atggccgccgcctacagcagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggcttggcc
tcagcgccgggccaatgacgagagagccccgcatccagaccctcctgtggccccaccctgcctgcagaccgtgctgcgga
gcgccggcgacgagttggagcgactttacggcaacgagctgtctgcgcaggtgacggtgctgcaactgcgtgggaacggc
ggtggcgctgcacgccggcgccacctgacggctatcagagaggagctgttcagggatggcgtgaactggggacgcatcgt
cgccatgatggagctgggcggagctctgagcaccgcggccgccaagtcgggcgacgaaggtcagatggacgatatcgcca
gctggatggaggagagtctggactcgccgttgctccggagatggatccatgacaacggaggatgggatgcttttgtggag
ctgtatgagtccagacccactgacagcttctggtccctgaggacagtgtgtggactggtcgtactgggagcagttggggt
catactgggatttctattcagccagaaacaaaactga
>gnl|bcl2dbcds|A0A3Q3CSD9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Haplochromis burtoni (length=681 residues).
atgtgccagatgatacactggtatgactggcaggagagatcgtggcatttgattagcctggccctgcagaggaggtccag
agtggagatgcagtgcaggaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaactt
cccttctgaggccaaccaatgtgggccaaaggactgagagagacctggccaaatccctgcctgcgtacgatggcatagag
gctttaaaatcagctcttctagactcaggggagcagtttggttttctgttcacacagtcttttagggacgttgcttcgca
cctcaacatcacgccagacacagcccagcaatgcttcgagagtgtgatggaggagttgttcagggatggaatcaattggg
ggcgtataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgggtgagctggtaccc
gacattgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctt
tacagagatatttgggaaagggatgtctactaggagctctggggagtctctgaagagatggctatttgttggagtggcat
tagtaacagggctgctggttggcatgctcatgacagattaa
© 1998-2019