Dataset for CDS BCL-2-like of organism Haplochromis burtoni

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q2UUP0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3Q2UUP0_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=816 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttgtga
>gnl|bcl2dbcds|A0A3Q2UYW8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q2VNL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Haplochromis burtoni GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacgtcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3Q2X557_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggctaacgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccaactgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
© 1998-2019