Dataset for CDS Unclassified of organism Gorilla gorilla gorilla

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3R922_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla (length=240 residues).
atggcgcgatctcggctcactgcaacctcagtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaactggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
© 1998-2018