Dataset for CDS BCL2A1 of organism Gorilla gorilla gorilla

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
© 1998-2018