Dataset for CDS BCL-2-like of organism Gopherus agassizii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A452I9V7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gopherus agassizii GN=BCL-2 (length=663 residues).
atgtatttaactgcatgtgtctgtacgttgcactggagggaaaagcacagtacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatatgattgggctgccaatgaaa
acagaggaccagtttcaccaaatctctctccccctactgttactgggacctcatctgaccatgctgggctgatgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctgcgcccagcaccgcaggctgttct
cttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgcccagatgtctggccagctgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaatttggtggtgtgatgtgtgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgactgaatacctgaacagacacctacacaactggatccaggacaacggaggctgggtatgtgtccagtatt
tctttctctttaaattacagtaa
>gnl|bcl2dbcds|A0A452ILL8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
cgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaact
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
actccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A452ILL8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
cgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaact
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
actccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A452J3N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2A1 (length=528 residues).
atggaaagctctgagtactgctatgtttactatttagtccaagattatctgaaatacgttcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacatttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaagcttcaagaacacag
agttcagcttacaggagaaaataaaaagcagatttcttatttcatcacagagtacattataaacaccaaggctgagtgga
tagaggcaaatggaggttgggaaaatggcttcctaactatgtttgaggaaaaacgatcatggctgtccttattcaatatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtactattga
© 1998-2019