Dataset for CDS Unclassified of organism Gasterosteus aculeatus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|G3PJ83_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gasterosteus aculeatus (length=546 residues).
atgtcgaacgagtgcaaccgccacattgtggaaaagtacatctgccataaactctccaaacgaggctacgcgttcggatt
cgatgacgtcggggaggaagacgcagccagcaacggctcgatggttgtcccgccgccgaccgcggtccgccggtgccgcg
aagccgggcccgacggcgagagcttcccgcgcctctgcaaacggctgccgcagtccgacccgaccgccgccgccacgcac
cgggtcctgcgcgaggctggagacgaactcgagcggctgtaccagccggacttcacggagatgtcgcggcagctgtacct
cacctccaccacggcgcagaggcggttcgccgaggtgatagacgagctgttccgggacggggtgaactggggccgcatca
tcgctttcttcgagttcggcgggacggtgtgcgcggagtgcgtggccaaggaggagatggcgtcgcaggtggacaacatc
gcggagtggatgacggagtatttgaatggacctctgaacatctggatacaagataacgggggatgg
>gnl|bcl2dbcds|G3PW08_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Gasterosteus aculeatus (length=603 residues).
cagtctgatatcgctgggaggaaaatgtcctgcgggctgtggaaagagaccttggctctggcagaggactacctgtacct
gtgctgcagcagcccacggccggcccctccacctcccagcgggtcagccgctgccatgaggctcctggcctgggacatgg
agacccagcaccaggcccgcttccacgccctcgcccagaccttcctcaggcagtgcgggccggacccctgctccagcctc
cggcaggtgatggaggagctggtgggggacggacacttgaactgggggagggttgtttcccttttcgcttttaccggggt
gctggccaggcagctcctggagcagaaggccacgaagctggggctggaccctgggcaggaactaggacaggagcccggaa
gctgcaggggactggcggagaccatagccgactacctgggagaggagaagaaggactggctgctggagaatgacggatgg
gaggggttctgcaagttctcccgcagcgccagagaagtcggccacgactcgtccatgaagaaagcgctgtttgctgctgc
tggcgtgggcctcgccggcctcaccttcctcctggtgcgctag
© 1998-2018