Dataset for CDS BCL2L1 of organism Gasterosteus aculeatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
© 1998-2018