Dataset for CDS MCL-1 of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A1D5PQZ2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=378 residues).
gaaaagtctaggggaatgcttcggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctca
cgttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctga
aaagcatcaaccaagagaaatgcatcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtgg
ctgatgagccagggaggctgggtgagtcactgcccaccacgaggctttcagaacgattcagtgtttcctatttccgtaac
ccactgggtgtcagctgcctgtgtcagcgaagtgcagatgagtcactgttccagttaa
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1008 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgaaagtggaggagttga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=996 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccggtga
© 1998-2018