Dataset for CDS BCL-2-like of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A1D5PQZ2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=378 residues).
gaaaagtctaggggaatgcttcggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctca
cgttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctga
aaagcatcaaccaagagaaatgcatcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtgg
ctgatgagccagggaggctgggtgagtcactgcccaccacgaggctttcagaacgattcagtgtttcctatttccgtaac
ccactgggtgtcagctgcctgtgtcagcgaagtgcagatgagtcactgttccagttaa
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1008 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgaaagtggaggagttga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=996 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|Q00709_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q00709_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=699 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgcccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctgc
gccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgccca
gatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtgatg
gggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcg
ccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggagg
atgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagaccatcc
tgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q07816_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q07816_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=573 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggtaagaac
tgctctcccatag
>gnl|bcl2dbcds|Q07816_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q9W6F2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gallus gallus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
ccttcttggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcacgg
agttcagctcactggagaggagaaggagaagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaacggtttcctaacgaagtttgaaagaagatcacccctatctttctctacaattaca
gacatatttgcagctgttctttccttgttcagagagtaccactga
© 1998-2018