Dataset for CDS BCL-2 of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|Q00709_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q00709_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=699 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgcccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctgc
gccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgccca
gatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtgatg
gggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcg
ccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggagg
atgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagaccatcc
tgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
© 1998-2018