Dataset for CDS BCL-2-like of organism Gadus morhua

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|D2IT42_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=588 residues).
atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagc
cccgccgcctcccagcgagtcagccgcggccatgaggggactggcccaggacatggagcggcagcactacgctcgcttcc
aggctctggcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtg
ggagacggacagttgaactgggggagggtagtttccctcttcacctttaccggggtgctggccagacaactgcaggagaa
gaagggggtacaactggggcaggaccccgggacgggcagggcactgggacaggttcccggcgggagctgcagggggctgg
cggagacgatagcggactacctaggggaggagaagagggactggctgctggagaacgggggctgggaagggttttgtaag
ttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgc
aggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|D2ITA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
© 1998-2018