Dataset for CDS BCL2L1 of organism Gadus morhua

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
© 1998-2018