Dataset for CDS Unclassified of organism Fundulus heteroclitus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q2PBH5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Fundulus heteroclitus (length=573 residues).
atggcgggctacagcagccgtgacgtcacagaaggctttctgcgccacaagctgctggaccggggcgtggcctggcgttt
cccaccccctcccagccagccagatgtggcatcaccggtaccacagaggccggaggagggcgccgggccggaccggctgc
ctctggcccggctgctggcggcgctgcagggcgccagcgacgagctggaggggcgttaccacagcgagctgcacggccag
gtggtggcgctgcagcagcaggacgtcagcggcgccgccacctgccgcagcctggagctggtccgggaggtgctgttcag
ggatggcgtgaactggggacgcattgtggccctgatgacgctgggcggagctctgagcaccgaggcggcccagacgggcc
agacgggccaggtggaccgcatcgccgcctggatggaggagagtctggagacgctccagggatggatccaggacaacgga
ggatgggtaggagtccatgatcacctgagaagcacatgggcttgtttctgcgctctgattggctgtgagcagatgcagct
ggcttcagtgtaa
© 1998-2019