Dataset for CDS MCL-1 of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|M3XAP4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|M3XAP4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=813 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttttaa
>gnl|bcl2dbcds|M3XAP4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2018