Dataset for CDS BCL-2-like of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A2I2UAE3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Felis catus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggattcacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A337RYG8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Felis catus GN=BCL2L10 (length=579 residues).
atggctgacgcgttgagggagcgcacggcgcagctactgactgactacctggagtactgcgcccgggagcccggcagccc
cgcgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttct
tgtcggcttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaa
accctcagttggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctactt
gaacctgacgccggaccagcaacaggagctggagtgggagaccaacgttggccaggactgccagcacctggtggctttgc
tctgcaatcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctca
cccatgctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgatcttaatctactt
ctggagaagattattgtga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=993 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggagataaggcttga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A337S3J9_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|M3X1R9_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=675 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctggctaatcttgctgcctcgtacctcgtatgaattaaaaagctcccgggctctccgtgaagacg
taagaatttcaccctcttttctttttaaagactag
>gnl|bcl2dbcds|M3X1R9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=714 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgt
ccctgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|M3XA94_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtctggactggcttattttaccctgagttcctggcacagggcctgaggttgggtaagggcttggccagcatctgct
caatgaacatgaggttattattagatgcaggttag
>gnl|bcl2dbcds|M3XA94_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=744 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggttgttattgagcaccaacggtgtgccaggctctgtgctccacagggtgcacacagcccagaacaaagcagcccat
ggagcacctcttctagagaaaggagacacgacggacaaggaaacaaacaagattgttccggggataaattgttctgcaac
caactaccccaaaacttaagctaa
>gnl|bcl2dbcds|M3XA94_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=816 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggtcagaacaaacgccgaaa
cagagctgccacagagagtttgtccggtcctggggacgacgccttgcctggatttcgctgggacgggaagggactgttgg
cctggaaggtggaggaaacctcctttgggcgggtctgaccactctgcacagctcccgtcccagggcagaagttcccggag
gagggggcggtgctga
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q8I008_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=708 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactatgagctgccgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgctgccgcgggccct
gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcga
cttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctct
tcagggatggcgtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagggcgtcaaccga
gagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccagga
taacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgtccctga
aggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
© 1998-2019