Dataset for CDS BCL2L10 of organism Felis catus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A337RYG8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Felis catus GN=BCL2L10 (length=579 residues).
atggctgacgcgttgagggagcgcacggcgcagctactgactgactacctggagtactgcgcccgggagcccggcagccc
cgcgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttct
tgtcggcttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaa
accctcagttggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctactt
gaacctgacgccggaccagcaacaggagctggagtgggagaccaacgttggccaggactgccagcacctggtggctttgc
tctgcaatcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctca
cccatgctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgatcttaatctactt
ctggagaagattattgtga
© 1998-2019