Dataset for CDS BCL2A1 of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A337STN9_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Felis catus GN=BCL2A1 (length=435 residues).
atggccgacggcgagtttgggtacgttctcacgctggcccgggactatacggagcacgttctgcaggggccccagcccgg
gtcccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccatgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggaatttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctggcactcagtacaagtttag
>gnl|bcl2dbcds|A0A337STN9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Felis catus GN=BCL2A1 (length=525 residues).
atggccgacggcgagtttgggtacgttctcacgctggcccgggactatacggagcacgttctgcaggggccccagcccgg
gtcccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccatgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggaatttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaagtctggctggctgacctttctggaagttaca
ggaaagatctgtaaggtattgtctctcctgaagaactactactga
© 1998-2018