Dataset for CDS BCL-2 of organism Equus caballus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7CDX6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
© 1998-2018